Creating Fragrant Corn with CRISPR/Cas9 Technology

Creating Fragrant Corn with CRISPR/Cas9 Technology

Popcorn produces pyrroline substances through the Maillard reaction during the popping process, giving off a fragrant aroma. Studies have found that the loss of function of betaine aldehyde dehydrogenase 2 (BADH2) in fragrant rice leads to the inability to oxidize γ-aminobutyraldehyde to γ-aminobutyric acid, and ultimately synthesizes a large amount of 2-acetyl-1-pyrroline (2AP) in the seeds, making the rice fragrant. The loss of function, reduced expression or weak mutation of BADH2 genes in soybeans, sorghum, mung beans, cucumbers and coconuts can lead to the production of 2AP. Through phylogenetic tree analysis, it was found that there are two homologous genes of OsBADH2 in corn, Zm00001d050339 (ZmBADH2a) and Zm00001d032257 (ZmBADH2b), which may be the reason why scented corn germplasm resources have not been created in spontaneous mutations and conventional corn breeding methods.

Gene editing technology can precisely edit target genes, providing tools for rapid crop improvement. This experiment used CRISPR/Cas9 gene editing technology to edit corn scent genes, and obtained T-DNA-free plants in the offspring, creating scented corn with 2AP, providing new resources for corn breeding, and also adding a new and effective way to increase the added value of corn.

Principle

CRISPR/Cas9 is a technology that can precisely edit specific sites in the genome. The principle is that the endonuclease Cas9 protein recognizes specific genomic sites through guide RNA (gRNA) and cuts double-stranded DNA. The cell then repairs the cut site using non-homologous end joining (NHEJ) or homologous recombination (HR) to achieve DNA-level gene knockout or precise editing.

The guide that guides Cas9 protein to recognize the target site of DNA is gRNA. gRNA is the key to constructing gene editing vectors. It is necessary to design specific sequences based on the characteristics of the target DNA. The design of gRNA targets is generally completed with the help of software.

Procedures

1. Determination of corn BADH2 gene

The protein sequence of OsBADH2 was obtained from the NCBI website, and then BLAST was performed with the corn genome to obtain the homologous gene of OsBADH2 in corn.

2. Target design

A. Download the target gene sequence from NCBI.

B. Design the CRISPR target site on the sequence of the first exon. The screened gRNA1 and gRNA2 target ZmBADH2a and ZmBADH2b at the same time. The target site sequences are shown in Table 1.

Table 1. ZmBADH2a and ZmBADH2b gRNA sequences

gRNA Sequence (5'-3') PAM
gRNA1 ggttgacgacggggaggcgg CGG
gRNA2 gcggcgctcaagaggaaccg CGG/TGG

3. Construction of CRISPR/Cas9 gene editing vector

A. Primer design and PCR amplification

Primers were designed according to the target site, plasmid Gly-tRNA was used as a template and its concentration was diluted 100 times, and PCR amplification was performed using specific primers (Table 2) according to the following reaction system (Table 3). The PCR reaction procedure is shown in Table 4.

Table 2. Gly-tRNA PCR Primers

Primer Name Primer Sequence
ZmBADH2-T1F TAGGTCTCTTGCAGGTTGACGACGGGGAGGCGGGTTTTAGAGCTAGAAATAGCAAGT
ZmBADH2-T2R TAGGTCTCTAAACCGGTTCCTCTTGAGCGCCGCTGCACCAGCCGGGAATCG

Table 3. Gly-tRNA PCR Reaction System

Components Volume/µL
Gly-tRNA 1.0
2.5 mmol/L dNTPs 4.0
5×Trans Start Fast Pfu Buffer 10.0
Primer 1 1.0
Primer 2 1.0
Trans Start Fast Pfu DNA Polymerase 1.0
ddH2O 32.0

Table 4. PCR Reaction Program

Cycling Steps Temperature/°C Time Number of Cycles
Pre-denaturation 95 2 min
Denaturation 95 20 s 35
Annealing 70 20 s
Extension 72 30 s
Complete extension 72 5 min

B. Vector construction

The recovered fragments of the PCR product and the vector Cas-Zm U6-tRNA were digested with Bsa I, and the 219 bp and 23 kb fragments were recovered by gel cutting, respectively, and digested at 37°C for 2 h. The two groups of recovered fragments were T4 ligated. When preparing the system, the ratio of Vector DNA: Insert DNA = 1:3 (molar ratio) can ensure the best efficiency of T4 DNA ligase. The ligation product was transformed into Escherichia coli, and plaques were picked in the culture medium containing Kan for bacterial liquid PCR to identify positive clones. The positive clones were shaken amplified in E. coli, and the plasmids were extracted, which were the constructed CRISPR/Cas9 vectors.

4. Obtaining genetically transformed engineered bacteria

The expression vector plasmid was transferred into EHA105 competent cell. The specific operation steps are as follows:

A. Take out the Agrobacterium competent cells from the -80°C refrigerator and mark them, and melt them in an ice bath.

B. Take 0.5 µL of plasmid DNA and add it to 50 µL of competent cells. Gently stir the bottom of the tube to mix it. Then, place it in an ice bath for 5 min, freeze it in liquid nitrogen for 5 min, heat shock it in a 37°C water bath for 5 min, and place it in an ice bath for 5 min.

C. Add 700 µL of LB medium without resistance, shake and culture it at 28°C, 200 r/min for 2-3 h.

D. Collect the bacteria by centrifugation at 6,000 r/min for 1 min, keep 100 µL of supernatant, resuspend the bacteria and spread it on the plate containing Kan and Rif, and place the plate upside down in an incubator at 28°C for 2-3 d.

E. Pick a single colony for PCR detection.

F. Shake the bacteria and maintain the bacteria.

5. Agrobacterium-mediated genetic transformation of corn

A. Preparation of infection medium

a. Streak Agrobacterium stored in -80°C refrigerator on YEB solid medium and culture overnight at 28°C.

b. Prepare infection medium and filter it with a bacterial filter. Add acetosyringone (AS) to the filtered infection medium and mix well.

c. Use the prepared infection medium to blow Agrobacterium until there is no particle, and adjust its OD to 0.3-0.4.

d. After adjusting the OD, wrap the centrifuge tube with tin foil, put it in a 22°C shaker, and shake it at 65 r/min for 2 h.

B. Preparation of explants

Take the female ears that have been pollinated for 10-15 d, peel off the bracts, soak them in 75% ethanol, and take them out after 10 min. Peel off the young embryos on the clean bench. The young embryos are 1.8-2 mm in size and are placed in a tube containing 2 mL of infection medium for standby use. Each tube contains 50-70 young embryos.

C. Explant infection

a. Wash the embryos in the tube three times with infection medium containing AD.

b. Heat shock at 43°C for 3 min, ice bath for 1 min, centrifuge at 4°C and 10,000 r/min for 20 min.

c. Add 1mL infection solution, invert and mix, infect for 5 min, and pour into a culture dish containing sterilized filter paper. After absorbing the excess bacterial solution, turn the filter paper upside down on the co-culture medium and quickly peel off the filter paper. Use tweezers to turn the embryos so that the shield of the embryos faces up, and co-culture at 22°C in the dark for 3 d.

d. After culturing on the co-culture medium for 3 d, transfer to recovery culture, and transfer to differentiation medium after 7-10 d of recovery at 25°C in the dark.

e. After 7 d of differentiation at 28°C in the dark, transfer to light for further differentiation, and transfer to rooting medium after 7 d.

f. Take samples when 2-3 leaves grow, and identify positive seedlings and gene-edited plants.

6. Identification of E0 generation edited seedlings

Use detection primers to PCR amplify the target gene, and then sequence the PCR amplification product with the correct band size. The editing type of homozygous mutation can be known by sequencing analysis, but in the peak graph of the sequencing results of the PCR product, samples with biallelic mutations and heterozygous mutations will produce overlapping peaks of two or more sequences starting from the mutation site, which is very difficult to analyze. For some samples that cannot confirm the editing form by peak analysis, it is necessary to dilute the PCR product and connect it to the T vector, pick a single clone for bacterial liquid PCR, and confirm the editing form.

Table 5. BADH2 Target Editing Detection Primers

Primer Name Primer Sequence
ZmBADH2A-JCF1 GAGACGTCCTCGCTTTCCAC
ZmBADH2A-JCR1 ATGTGCACGCTGCGTTTTAC
ZmBADH2B-JCF1 GTCGCAATCTCCACTCTCCA
ZMBADH2B-JCR1 GCTTGGAAGCAGAAGCACAG

Note: Cited from Wang et al., 2021.

7. T-DNA element detection of homozygous mutant plants in the E1 generation

In the E1 generation, T-DNA element detection was performed using Cas detection primers Cas-F1/R1 and Cas-F3/R3. Plants without bands in both pairs of primers during electrophoresis detection were mutant plants without T-DNA elements in the E1 generation.

Table 6. Primers for T-DNA Element Detection

Primer Name Primer Sequence
Cas9-F1 AAGAAGCGGAAGGTCGGTAT
Cas9-R1 CTCAGGTGGTAGATGGTGGG
Cas9-F3 CAGAAAGAGCGAGGAAACCA
Cas9-R3 CCTCAAACAGTGTCAGGGTCA

Note: Cited from Wang et al., 2021.

Agrobacterium Competent Cells We Offer

Cat# Product Name Size
ACC-100 GV3101 Chemically Competent Cell 10 tubes (100μL/tube)
20 tubes (100μL/tube)
50 tubes (100μL/tube)
100 tubes (100μL/tube)
ACC-103 EHA105 Chemically Competent Cell 10 tubes (100μL/tube)
20 tubes (100μL/tube)
50 tubes (100μL/tube)
100 tubes (100μL/tube)
ACC-105 AGL1 Chemically Competent Cell 10 tubes (100μL/tube)
20 tubes (100μL/tube)
50 tubes (100μL/tube)
100 tubes (100μL/tube)
ACC-107 LBA4404 Chemically Competent Cell 10 tubes (100μL/tube)
20 tubes (100μL/tube)
50 tubes (100μL/tube)
100 tubes (100μL/tube)
ACC-108 EHA101 Chemically Competent Cell 10 tubes (100μL/tube)
20 tubes (100μL/tube)
50 tubes (100μL/tube)
100 tubes (100μL/tube)
ACC-117 Ar.Qual Chemically Competent Cell 10 tubes (100μL/tube)
20 tubes (100μL/tube)
50 tubes (100μL/tube)
100 tubes (100μL/tube)
ACC-118 MSU440 Chemically Competent Cell 10 tubes (100μL/tube)
20 tubes (100μL/tube)
50 tubes (100μL/tube)
100 tubes (100μL/tube)
ACC-119 C58C1 Chemically Competent Cell 10 tubes (100μL/tube)
20 tubes (100μL/tube)
50 tubes (100μL/tube)
100 tubes (100μL/tube)
ACC-121 K599 Chemically Competent Cell 10 tubes (100μL/tube)
20 tubes (100μL/tube)
50 tubes (100μL/tube)
100 tubes (100μL/tube)
ACC-122 Ar.A4 Electroporation Competent Cell 10 tubes (50μL/tube)
20 tubes (50μL/tube)
50 tubes (50μL/tube)

Related Services

For research or industrial raw materials, not for personal medical use!
Online Inquiry
Back to School Sale 2026